Journal: bioRxiv

Article Title: β2-Adrenergic Biased Agonist Nebivolol Inhibits the Development of Th17 and the Response of Memory Th17 Cells in an NF-κB-Dependent Manner

doi: 10.1101/2024.09.08.611829

Figure Lengend Snippet: Effect of A) β1AR antagonist (metoprolol) and B) non-selective βARs antagonist (bupranolol) on the production of IL-17A on memory Th cells. Activated memory Th cells were blocked for 30 minutes with metoprolol or bupranolol before treatment with nebivolol and incubated for five days. IL-17A was measured in cell culture supernatants. Pooled data are expressed as the Mean ± SEM of four independent biological experiments. Effect of CRISPR/Cas9-mediated knockout of β2AR on nebivolol treatment in activated memory Th cells. Stimulated memory Th cells were electroporated with a CRISPR/Cas9 system targeted by multi-sgRNA against β2AR or non-targeting genes. C) The expression of ADRB2 at mRNA levels as verification in non-electroporated, non-targeting and β2 multi-sgRNA conditions has shown as the relative amounts normalized to housekeeping RNA and compared to a control set to 1.0 (dotted line). The data of this figure is representative of three independent biological experiments. Three days after electroporation, memory Th cells were cultured with or without nebivolol for another 5 days and D) A representative of IL-17A levels in cell culture supernatants in both control and knock-out β2AR conditions was shown. ANOVA was followed by Tukey’s multiple comparisons tests.

Article Snippet: According to published protocols ( , ), before electroporation briefly, 100 pmol of optimized multi single-guide RNA (sgRNA) (payload sequences attached in supplementary table1) (Synthego, USA) and 50 pmol of Cas9 (Thermofisher, CA) per 1 million cells were mixed in 5 μL of Resuspension Buffer R and incubated at room temperature for 10 minutes to form the Cas9-ribonucleoprotein (RNP) complex.

Techniques: Incubation, Cell Culture, CRISPR, Knock-Out, Expressing, Control, Electroporation

Journal: Journal of Extracellular Vesicles

Article Title: Identification of a Biomarker Panel in Extracellular Vesicles Derived From Non‐Small Cell Lung Cancer (NSCLC) Through Proteomic Analysis and Machine Learning

doi: 10.1002/jev2.70078

Figure Lengend Snippet: Elevated CD155 expression in EVs from NSCLC cells and patient plasma compared with healthy individuals. (A) Western blotting analysis of CD155 in EVs isolated from NSCLC and control cell lines. (B) Flow cytometry analysis of CD155 and CD63 in EVs isolated from H1975 and BEAS‐2B cells. (C) Western blotting analysis of CD155 abundance in EVs from the plasma of patients with NSCLC and healthy individuals in three independent tests. (D) Quantitative assessment of the fold change in CD155 expression from panel C, normalized to whole protein. (E) CD155 expression in EVs isolated from plasma of patients with NSCLC (LUAD, n = 20; LUSC, n = 4) and healthy individuals ( n = 16) using ELISA. (F) ROC curve analysis of the diagnostic potential of EV‐CD155 in distinguishing patients with NSCLC from healthy individuals. (G) Pearson correlation analysis of CD155 expression in EVs and tumour size in patients with NSCLC ( n = 24). (H) IHC analysis for CD155 expression in NSCLC tissue microarrays. Left: IHC staining images of paired tumour tissues (TT) and adjacent tumour tissues (ATT) ( n = 35). Right: quantitative analysis of IHC intensity for CD155 ( n = 49). T1, T2, and T3 in the quantification data refer to the tumour stages defined by the TNM classification system of NSCLC.

Article Snippet: For CD155 gene knockout (KO), a single‐guide RNA (sgRNA) targeting CD155 (human CD155 sgRNA: 5′‐CACCGCTGTTCGTCACGTTCCCGCA‐3′, 5′‐AAACTGCGGGAACGTGACGAACAGC‐3′) synthesized by Sangon Biotech (Beijing, China) and cloned into the lentiCRISPRv2 vector (Addgene, #52961).

Techniques: Expressing, Clinical Proteomics, Western Blot, Isolation, Control, Flow Cytometry, Enzyme-linked Immunosorbent Assay, Diagnostic Assay, Immunohistochemistry

Journal: Journal of Extracellular Vesicles

Article Title: Identification of a Biomarker Panel in Extracellular Vesicles Derived From Non‐Small Cell Lung Cancer (NSCLC) Through Proteomic Analysis and Machine Learning

doi: 10.1002/jev2.70078

Figure Lengend Snippet: Cellular origin and membrane localization of CD155 in EVs. (A) Immunofluorescence analysis of H1975 cells showing CD155 displayed higher co‐localization with CD63 and Rab5 than Rab7. Nuclei were stained with DAPI. Scale bars: 10 µm. (B) Quantitative analysis of Pearson's correlation coefficients demonstrating the co‐localization between CD155 with CD63, Rab5, and Rab7 in H1975 cells. (C) Western blotting analysis of cellular and EV CD155 treated with different endoglycosidases. PNGase F effectively removes the oligosaccharide chains of CD155, whereas these chains are resistant to Endo H cleavage. (D) Representative iEM images of EVs isolated from H1975 and BEAS‐2B cells. EVs were stained with anti‐CD155 antibodies. Scale bars: 100 nm. (E) Western blotting analysis of the immunocaptured EVs derived from H1975 cells using antibody against CD63 or CD155. (F) Representative iEM images of plasma EVs demonstrating CD155 localized on the EV membrane rather than within the lumen. Scale bars: 100 nm.

Article Snippet: For CD155 gene knockout (KO), a single‐guide RNA (sgRNA) targeting CD155 (human CD155 sgRNA: 5′‐CACCGCTGTTCGTCACGTTCCCGCA‐3′, 5′‐AAACTGCGGGAACGTGACGAACAGC‐3′) synthesized by Sangon Biotech (Beijing, China) and cloned into the lentiCRISPRv2 vector (Addgene, #52961).

Techniques: Membrane, Immunofluorescence, Staining, Western Blot, Isolation, Derivative Assay, Clinical Proteomics